sinR [2019-08-15 14:15:36]

transcriptional regulator (Xre family) of post-exponential-phase responses genes

Locus: BSU_24610

Isoelectric point: 7.18

Molecular weight: 12.85 kDa

Protein length: 111 aa

Gene length: 336 bp

Function: control of biofilm formation

Product: transcriptional regulator (Xre family)

Essential: no

Synonyms: sin,flaD

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other
• Information processing → Regulation of gene expression → Transition state regulators
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation
• Lifestyles → Exponential and early post-exponential lifestyles → Biofilm formation → Regulation
• Lifestyles → Exponential and early post-exponential lifestyles → Swarming

Gene

Coordinates: 2,552,653 2,552,988

Phenotypes of a mutant

• the mutation suppresses the galactose toxicity to a galE mutant PubMed

The protein

Catalyzed reaction/ biological activity

• transcription regulator of biofilm genes, acts as a true repressor of the tapA-sipW-tasA operon and as an anti-activator (prevents binding of the activator protein RemA) of the epsA-epsB-epsC-epsD-epsE-epsF-epsG-epsH-epsI-epsJ-epsK-epsL-epsM-epsN-epsO operon PubMed
• acts as co-repressor for SlrR PubMed

Protein family

• Xre family

Paralogous protein(s)

• SlrR

Domains

• DNA-binding N-terminal domain (aa 1-69) PubMed
• SinI-binding C-terminal domain (aa 74-111) PubMed

Effectors of protein activity

• SinI and SlrA are antagonists to SinR PubMed
• SlrR is also antagonist of SinR PubMed

Structure

• 2YAL (C-terminal domain, aa 74-111) PubMed
• 3QQ6 (N-terminal domain, aa 1-69) PubMed
• 1B0N (complex SinR-SinI) PubMed

Additional information

• information on binding sites can be found in the PRODORIC2 database

Expression and Regulation

Operons

• Genes: sinI-sinR
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • Spo0A: activation, in a portion of cells PubMed, in Spo0A regulon
  • SinR: repression, PubMed, in SinR regulon
  • AbrB: repression, PubMed, in AbrB regulon
  • ScoC: repression, PubMed, in ScoC regulon

  Regulation

  • repressed during exponential growth (ScoC) PubMed

  Additional information

  • the mRNA is stabilized upon depletion of RNase Y PubMed

• Genes: sinR
  Description: PubMed

  Additional information

  • the mRNA is stabilized upon depletion of RNase Y (the half-life of the mRNA increases from 3.5 to 13 min) PubMed

Biological materials

Mutant

• GP923 (sinR::spec) PubMed, available in Jörg Stülke's lab
• GP736 (sinR::tetR) PubMed, available in Jörg Stülke's lab
• 1S97 (sinR::phleo), PubMed, available at BGSC
• GP1672 (sinR-tasA::cat) PubMed, available in Jörg Stülke's lab
• GP1663 (yqhG-sinI-sinR-tasA), available in Jörg Stülke's lab
• BKE24610 (sinR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATGTCATCACCTTCCTTG, downstream forward: _UP4_TAGTGCCTGAGCAGAGGCAC
• BKK24610 (sinR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATGTCATCACCTTCCTTG, downstream forward: _UP4_TAGTGCCTGAGCAGAGGCAC

Expression vectors

• N-terminal Strep-tag, for SPINE, expression in B. subtilis, in pGP380: pGP1083 , available in Jörg Stülke's lab

LacZ fusion

• pGP1930 (aphA3) based on pAC7, available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

FLAG-tag construct

• GP960 (spc, based on pGP1331), available in Jörg Stülke's lab

References

Reviews

Loading

Modelling of the SinI/SinR switch

Loading

Original publications

Loading